pocketz.doi.bio/2025-08-29_144100_nature_nature22036/2025-08-29_144100_nature_nature22036

Mechanism of chromatin remodelling revealed by the Snf2-nucleosome structure | Nature

URL: https://www.nature.com/articles/nature22036

Saved: 2025-08-29T21:41:07.145Z

Mechanism of chromatin remodelling revealed by the Snf2-nucleosome structure Download PDF Article Published: 19 April 2017 Mechanism of chromatin remodelling revealed by the Snf2-nucleosome structure Xiaoyu Liu, Meijing Li, Xian Xia, Xueming Li & Zhucheng Chen 

Nature volume  544,  pages 440–445 (2017)Cite this article

29k Accesses

220 Citations

36 Altmetric

Metrics details

Abstract

Chromatin remodellers are helicase-like, ATP-dependent enzymes that alter chromatin structure and nucleosome positions to allow regulatory proteins access to DNA. Here we report the cryo-electron microscopy structure of chromatin remodeller Switch/sucrose non-fermentable (SWI2/SNF2) from Saccharomyces cerevisiae bound to the nucleosome. The structure shows that the two core domains of Snf2 are realigned upon nucleosome binding, suggesting activation of the enzyme. The core domains contact each other through two induced Brace helices, which are crucial for coupling ATP hydrolysis to chromatin remodelling. Snf2 binds to the phosphate backbones of one DNA gyre of the nucleosome mainly through its helicase motifs within the major domain cleft, suggesting a conserved mechanism of substrate engagement across different remodellers. Snf2 contacts the second DNA gyre via a positively charged surface, providing a mechanism to anchor the remodeller at a fixed position of the nucleosome. Snf2 locally deforms nucleosomal DNA at the site of binding, priming the substrate for the remodelling reaction. Together, these findings provide mechanistic insights into chromatin remodelling.

Similar content being viewed by others Energy-driven genome regulation by ATP-dependent chromatin remodellers Article 11 December 2023 Structure of human chromatin-remodelling PBAF complex bound to a nucleosome Article 27 April 2022 A competitive regulatory mechanism of the Chd1 remodeler is integral to distorting nucleosomal DNA Article 28 May 2025 Main

Packaging of genomic DNA into chromatin in eukaryotic cells serves to store and protect the genetic materials. However, this creates an obstacle to accessing to the genetic information. Cells have evolved a large family of chromatin remodelling enzymes that alter the chromatin structure and allow access to the DNA as required1.

Chromatin remodellers are superfamily II (SF2) helicase/translocase-like proteins, which include Snf2, imitation switch (ISWI), Swr1 and Chd1. These proteins share a common catalytic core, but each subfamily member has distinct auxiliary domains that confer specific properties on different remodellers1,2. Their association with other subunits within large complexes further increases the diversity of the remodellers.

The conserved catalytic core of each remodeller consists of two RecA-like domains, which perform the basic function of coupling nucleic acid binding and ATP hydrolysis to chromatin remodelling. The biochemical activity of the chromatin remodellers is remarkable given the complexity of their substrate, the nucleosome. The nucleosome core particle (NCP) contains about 146 base pairs (bp) of DNA tightly wrapping in ~1.7 turns around a histone octamer via many DNA–histone contacts3. Chromatin remodellers are able to overcome these DNA–histone contacts, slide the histone octamer along the DNA, catalyse histone exchange and alter the structure of the nucleosome and even evict it1,2. A DNA wave/bulging model has been proposed to explain the sliding reaction4,5,6. However, the underlying structural basis of this process is largely unclear. Very few crystal structures of real chromatin remodellers have been reported7,8,9, and the currently available structures of remodellers in complex with the nucleosome substrate are at very low resolution10,11,12,13,14,15,16.

To understand how the remodellers interact with the nucleosome substrate, we determined the cryo-electron microscopy (EM) structures of Snf2 in complex with a mononucleosome. Our work illustrates the structure of an active remodeller engaging with its substrate, shedding mechanistic light on the remodelling process.

Overall structure of the Snf2–NCP complex

NCPs were assembled with a 167-bp DNA fragment (NCP-167), containing a ‘601’ positioning sequence, an extranucleosomal linker DNA (20 bp) at one end and no linker DNA at the other end17. A truncated Snf2 (residues 666–1400) from S. cerevisiae (ScSnf2), which has been shown to be highly active in ATP hydrolysis and chromatin remodelling7, was used to form a complex with the NCP-167 in the absence of nucleotide. Three-dimensional reconstruction of the complex was determined using cryo-EM (Fig. 1 and Extended Data Fig. 1), which revealed that ScSnf2 binds the NCP-167 at two different positions: one around super-helical location 2 (SHL2) and the other around SHL6 (Extended Data Fig. 2). A small fraction of the enzymes was found to bind the nucleosomes simultaneously at both sites (Extended Data Fig. 2 inset).

Figure 1: Overall structure of Snf2 bound to the nucleosome around SHL2.

Two different views of the cryo-EM density map superimposed with the structures of ScSnf2 and the nucleosome. ScSnf2, green; histone H4, gold; H3, blue; H2A, cyan; H2B, purple; 5′-DNA, red; 3′-DNA, yellow. The linker DNA is invisible under the contour level set to show high-quality maps of Snf2 and NCP.

PowerPoint slide

Full size image

SHL2 of the NCP is a well-known strategic interaction site for Snf2 and ISWI remodellers2,4,18,19,20. The structure of ScSnf2 bound at SHL2 (the SHL2 complex) was reconstructed at a resolution of 4.69 Å and is discussed here. The structure of ScSnf2 bound at SHL6 (the SHL6 complex) was reconstructed at a higher overall resolution (3.97 Å), which adopts essentially the same structure as that at SHL2 (Extended Data Fig. 3), further supporting the assignment of the secondary structures of the enzyme. The binding of Snf2 at SHL6 was unexpected, which may be specific to the isolated Snf2 enzyme. The biological significance of the SHL6 complex requires further validation.

Three-dimensional reconstruction of the samples shows that ScSnf2 seems to preferentially bind to the NCP at the side proximal to the linker DNA, which is referred to here as the entry point of the nucleosome (Fig. 1). Presumably owing to the proximity to the linker DNA, the entry point DNA shows higher flexibility than the distal DNA end (referred to as the exit point). Similarly, the entry point DNA of the free NCP-167, which was reconstructed at a resolution of 3.92 Å, also shows higher flexibility than the exit point DNA under the same conditions (Extended Data Fig. 1i). This asymmetric feature of NCP-167 helps to orient the crystal structure of the ‘601’ nucleosome into the EM density map21, and the greater flexibility probably makes the entry point DNA the preferential site of binding. We cannot exclude the possibility that Snf2 binding at the exit point of NCP-167 might fail to provide a defined structure that could be detected by the cryo-EM protocol we used.

The remodeller at SHL2 mainly contacts the nucleosome through the DNA components, with additional interactions with the proximal histone H4 tail (Fig. 1). A local resolution analysis indicated that the phosphate backbones of the nucleosomal DNA mostly keep their registry on the surface of the histone octamer, with some distortion round the site bound by ScSnf2 (Extended Data Fig. 4a, b). The remodeller part of the complex is at a resolution of 5.04 Å, which clearly defines the secondary structural elements of ScSnf2 (Extended Data Fig. 4c). The two RecA-like core domains of ScSnf2 maintain their overall structures like those of the closely related homologue from the thermophilic yeast Myceliophthora thermophila (MtSnf2) in the absence of the substrate7, with some local conformational changes and a large rotation of their relative orientation upon nucleosome binding.

Structure of Snf2 in nucleosome-bound state

Previous study has indicated that ScSnf2 (666–1400) contains the postHSA, catalytic core and SnAc domains7 (Fig. 2a). The core1 and core2 domains of MtSnf2 stack together in the resting state, leading to an inactive conformation. Upon NCP binding, the relative orientation of the two core domains of ScSnf2 is rotated by ~80° (Extended Data Fig. 5), which generates a new core1–core2 interface through direct contact between two newly formed Brace helices (Brace-I and Brace-II) of the core2 domain and the SuppH helix (also named Protrusion 1) of the core1 domain (Fig. 2b). Helicase motif VI (arginine fingers) is disordered in the resting state, but becomes ordered in the nucleosome-bound state. Moreover, motif VI is brought into close proximity with the ATP-binding element of motif I (P-loop), explaining the activation of the ATPase activity of the enzyme upon nucleosome binding (Extended Data Fig. 5).

Figure 2: Structure of Snf2 in the nucleosome-bound state.

a, Domain organization of Snf2. PostHSA, core1, SuppH, core2, Brace helices and SnAc are magenta, green, yellow, cyan, red and orange, respectively. b, Overall structure of ScSnf2 in the nucleosome-bound state. Nucleosomal DNA bound within the core1–core2 cleft, grey circle. c, Conformational changes of the core1 domain. Structure of the core1 domain of MtSnf2 in the resting state is grey (Protein Data Bank (PDB) accession number 5HZR)7. Arrows indicate the movement of SuppH and postHSA upon nucleosome binding. d, Conformational changes of the core2 domain. e, Sequence alignments around of the Brace helix region of four Snf2 subfamily proteins. Residues mutated in this study are highlighted in yellow. f, DNA- (black bars) and NCP- (white bars) stimulating ATPase activities. Error bars, s.d. (n = 3). g, Chromatin remodelling activity. Wild type (WT) interface, black square; L977D, yellow; V1235D, red triangle; L1254D, red diamond. The activities of the mutants were barely detectable and are further shown in the inset. Error bars, s.d. (n = 3). For gel source data, see Supplementary Fig. 1.

PowerPoint slide

Full size image

The individual lobes of the enzyme undergo local conformational changes. Within lobe1, postHSA and SuppH contact each other in the resting state, and they show coordinated movement upon nucleosome binding (Fig. 2c)7. PostHSA, which has been shown to downregulate the activity of the enzyme22, is not directly involved in substrate binding or core1–core2 communication, suggesting it may negatively regulate the remodelling activity through SuppH. Within lobe2, the Brace helices of MtSnf2 are mostly disordered in the resting state7. Upon nucleosome binding, the equivalent sequence of ScSnf2 forms two helices (Fig. 2d). These two newly formed helices protrude from the core2 domain and contact the core1 domain, particularly through interactions with SuppH.

The structure suggests that the Brace–SuppH contact functions in core1–core2 communication in the substrate-bound state. The Brace helices and SuppH, both of which are highly conserved among the Snf2 subfamily of remodellers, interact with each other mainly through hydrophobic residues (Fig. 2e). Mutations V1235D of Brace-I and L1254D of Brace-II diminished the DNA- and nucleosome-stimulating ATPase activities of the enzyme by two- to fivefold (Fig. 2f). More importantly, these mutations severely abrogated the remodelling activity (Fig. 2g and Extended Data Fig. 6a). Likewise, the L977D mutation of SuppH dramatically reduced the remodelling activity, whereas the ATPase activities of the mutant were reduced approximately twofold. The SuppH–Brace helix interactions are unexpected and only form in the substrate-bound state, playing an important role for the activities of Snf2, particularly in coupling ATP hydrolysis to chromatin remodelling. Interestingly, several mutations in the SuppH of Sth1 were found to suppress the lethal phenotype of Arp7 and/or Arp9 deletion in yeast23. Our model provides the structural basis for the increase of the remodelling activity of the Sth1 suppressor mutants, L681F in particular, through enhancement of the hydrophobicity of SuppH22.

The importance of the Brace-I helix is not specific to the Snf2 subfamily proteins, and it extends to the remodeller ISWI. Mutation of the Brace helix of ISWI from M. thermophila (MtISWI) (V638D, corresponding to V1235D of ScSnf2; Extended Data Fig. 7) has also been shown to decouple ATP hydrolysis from chromatin remodelling9, suggesting various chromatin remodellers use a conserved mechanism of core1–core2 communication. However, the ATPase domains of Snf2 and ISWI are not interchangeable19,24. One characteristic element of the Snf2 subfamily proteins is the Brace-II helix, which is absent in ISWI. Instead, ISWI contains NegC (Extended Data Fig. 7), which protrudes from the core2 domain and negatively regulates the enzyme9,25. In contrast, the Brace-II helix interacts with the Brace-I helix, playing a positive role in supporting the activity of Snf2.

Snf2–hisone H4 contacts

One feature of ScSnf2 at SHL2 of the nucleosome is the interaction with the amino (N)-terminal tail of H4, which extends from the dish-face of the nucleosome and contacts a highly negatively charged surface of the core2 domain (Extended Data Fig. 8a). This surface of ScSnf2 corresponds to the acidic pocket of ISWI that binds to the basic patch of H4 (Extended Data Fig. 8b)9,25. The conserved sequence and structure suggest that the acidic surface of ScSnf2 may bind to the basic patch of the H4 tail. Consistent with this notion, disruption of the acidic pocket of Snf2 (KK, E1069K D1121K) markedly weakened the binding of the protein to the H4 tail (Extended Data Fig. 8c). The structural integrity of the KK mutant was maintained, as suggested by the intact ATPase activity (Extended Data Fig. 8d). Likewise, mutations of the basic patch of H4 reduced the binding interaction (Extended Data Fig. 8e).

The H4 tails of the nucleosome are important for the activation of ISWI remodellers, but seem to be less so for the regulation of Snf2 enzymes1. In fact, the H4-binding KK mutation of Snf2 slightly but reproducibly reduced the remodelling activity approximately two- to threefold (Extended Data Fig. 8f). To validate the Snf2–H4 interaction further, we reconstituted mutant nucleosomes without the H4 tail (gH4-NCP). Relative to the intact nucleosome, Snf2 showed an approximate twofold reduction in the remodelling activity towards gH4-NCP (Extended Data Fig. 8f). Taken together, these results suggest that the H4 tails of the nucleosome bind to Snf2, reinforcing its remodelling activity in vitro.

Compared with the dramatic loss of the remodelling activity of Snf2 caused by the mutations of Brace and SuppH, the impact of H4 binding is modest in vitro, and its significance within the holo-complex, particularly insides the cells, will require further examination. It is interesting to find that the H4 tails bind to a similar surface patch in Snf2 and ISWI, but play different regulatory roles. The H4-binding sites are critical for ISWI and protected by AutoN, yet the equivalent elements weakly modulate Snf2 and are exposed to solvent, consistent with the conserved but not exchangeable catalytic cores of the remodellers7,9,19,24.

Primary contacts between nucleosomal DNA and Snf2

ScSnf2 engages with its nucleosome substrate extensively through the DNA components via a cleft formed by the central core1 and core2 domains (Fig. 3a). Unlike a previous hypothesis19, ScSnf2 does not intercalate between the DNA and the histone octamer. Instead, it associates with the exposed DNA surface. The core1 domain wedges between the two gyres of the nucleosomal DNA, and the core2 domain binds the DNA close to the dish-face of the nucleosome. The remodeller interacts with the phosphate backbones along the minor groove of the two strands of the nucleosomal DNA18 (Fig. 3b), consistent with the lack of sequence specificity in DNA binding by the remodeller.

Figure 3: Binding of the nucleosomal DNA by Snf2.

a, Overall interaction between ScSnf2 and the nucleosomal DNA. b, Interaction between the nucleosomal DNA and the core1–core2 cleft. Elements of ScSnf2 involved in DNA contact are coloured blue and the corresponding helicase motifs are indicated in parentheses. The DNA bases are numbered on the basis of the 5′-strand starting from the ‘601’ sequence. Right, schematic diagram of the primary DNA interactions. c, DNA- (black bars) and NCP- (white bars) stimulating ATPase activities. Error bars, s.d. (n = 3). d, Chromatin remodelling activities. Wild type, black square; S826D, green circle; T1113D, cyan triangle; W1185D, cyan diamond. Error bars, s.d. (n = 3). For gel source data, see Supplementary Fig. 1.

PowerPoint slide

Full size image

The binding of DNA by ScSnf2 involves multiple conserved helicase and non-helicase motifs within the core1–core2 cleft. For simplicity, the DNA strand with its 5′ end located at the entry point of the nucleosome is called the ‘5′-strand’, and the complementary strand is the ‘3′-strand’. The core1 domain of ScSnf2 binds to the nucleosomal DNA in a manner similar to that of SsoRad54 in complex with naked DNA26 (Extended Data Fig. 9). Helicase motifs Ia centring on S826 and Ib centring on K878 are close to the 5′-strand. Consistent with the structure, S826D mutation of motif Ia severely attenuated the ATPase (Fig. 3c) and chromatin remodelling activities (Fig. 3d and Extended Data Fig. 6b). The structure is also supported by previous biochemical analyses, which showed that mutation of the equivalent residue of K878 of motif Ib in MtSnf2 abrogated the remodelling activity7. Likewise, most of motif II of MtSnf2 is disordered in the resting state, but the equivalent region of ScSnf2 becomes ordered upon binding to the NCP, making extensive contacts with the 3′-strand. Mutation of motif II of MtSnf2 has also been shown to disrupt the activities of the enzyme.

The core2 domain contacts the nucleosomal DNA through canonical helicase motifs IV and V. This structure is in agreement with the previous study showing the cross-linking of the region between motifs IV and V to nucleosomal DNA19, but differs from the model of SsoRad54, in which motifs IV and V are distal to the DNA-binding cleft (Extended Data Fig. 9)26. Motif IV centring on T1113 and motif V centring on Arg1164 of ScSnf2 interact with the backbone of the 5′-strand. Supporting our model, T1113D mutation of motif IV diminished the activities of the remodeller (Fig. 3c, d). Similarly, mutation of motif V has been shown to abolish the remodelling activity of the enzyme7,27.

In addition to the canonical helicase motifs, other elements of ScSnf2 within the core1–core2 cleft are also involved in nucleosome binding. We found a tryptophan residue upstream motif VI (W1185), which is conserved not only in the Snf2 subfamily proteins, but also in Chd1 and ISWI remodellers9. The bulky side chain of W1185 inserts into the minor groove of the nucleosomal DNA, and packs against the backbone of the 3′-strand (Fig. 3b and Extended Data Fig. 4d). Whereas the W1185A mutation modestly modulated the ATPase activity, the mutant dramatically lost its remodelling activity (Fig. 3c, d). W1185 of ScSnf2 is located at the N terminus of motif VI, which senses the γ-phosphate group of ATP through the ‘arginine fingers’ (R1196 and R1199)7. Thus, W1185 is involved in dual connections both to the ATP sensing elements and to the nucleosome substrate, which may enable it to link ATP hydrolysis to the associated conformational change to perturb the DNA–histone binding, coupling ATP hydrolysis and nucleosome remodelling.

In ScChd1, R750 located between motif IV and motif V of the core2 domain has been suggested to bind DNA8, and the equivalent residue of ScSnf2 (R1142) is close to the 5′-strand (Fig. 3b). A previous study showed that the insertion sequence within the core2 domain (core2i) is implicated in nucleosome binding7. Consistent with this study, core2i is in close proximity to the minor groove near dG(−49) of the 3′-strand and dG52 of the 5′-strand.

Most of the nucleosomal DNA-binding elements described above, including the helicase motifs (Ia, Ib, II, IV and V), W1185 and R1142 of ScSnf2, are conserved in the Snf2, ISWI and Chd1 protein subfamilies9. Our model may be used as a prototype to investigate the mechanism of nucleosome binding by the catalytic cores of other remodellers.

Secondary nucleosomal DNA contacts of Snf2

ScSnf2 at SHL2 not only binds the nucleosomal DNA via the core1–core2 cleft, but also contacts the adjacent DNA gyre at SHL-6 through a highly positively charged surface patch of the core1 domain (Fig. 4a). Several conserved basic residues (K855, R880 and K885 of ScSnf2) were identified (Fig. 4b), suggesting that they may function as the secondary DNA-binding elements. This notion is supported by the higher-resolution structure at SHL6, with the side chain of R880 contacting the 3′-strand (Extended Data Fig. 4e). Consistent with the structure, R880E K885E double mutation reduced the nucleosome-dependent ATPase by about twofold (Fig. 4c), whereas it had less impact on the DNA-dependent ATPase activity, suggesting a specific role for these residues in nucleosome recognition. More importantly, relative to the protein with an intact interface, the initial rate of the remodelling reaction catalysed by the R880E K885E mutant was reduced by over 30-fold (Fig. 4d and Extended Data Fig. 6c).

Figure 4: Binding of nucleosomal DNA to the secondary DNA-binding sites of Snf2.

a, Binding of ScSnf2 to both DNA gyres of the nucleosome. Electrostatic surface is calculated with Pymol. The secondary DNA-binding sites of ScSnf2, yellow dots. b, Multiple sequence alignments of Snf2 subfamily remodellers around the secondary DNA-binding sites. c, DNA- (black bars) and NCP- (white bars) stimulating ATPase activities. Error bars, s.d. (n = 3). d, Remodelling activities. Wild type, black square; K855E, green circle; R880E, red triangle; K885E, blue diamond; R880E K885E, magenta inverted triangle. Error bars, s.d. (n = 3). For gel source data, see Supplementary Fig. 1.

PowerPoint slide

Full size image

The relatively mild defects in the ATPase activity of these mutants are consistent with the idea that the enzyme binds tightly to and is activated by the nucleosome through the primary nucleosome-binding surface. The secondary nucleosome-binding surface is not essential for ATP hydrolysis per se, but is important in coupling ATP hydrolysis to chromatin remodelling. ScSnf2 embraces one DNA gyre of the nucleosome through its primary DNA-binding sites and binds to the other DNA gyre through its secondary DNA-binding sites, which would prevent rotation of the enzyme along the primary DNA gyre. Thus, disruption of the secondary interactions would not perturb ATP hydrolysis much, but probably disfavour the anchorage of the motor, leading to loss of nucleosome remodelling. More studies are needed to examine the dynamics of this system further.

Directionality of DNA translocation

The mechanism of nucleosome engagement by ScSnf2 suggests the directionality of DNA translocation. The Snf2 subfamily remodellers are SF2 translocases that move along free double-stranded DNA, showing 3′-5′ polarity by tracking one DNA strand (the tracking strand)28. This translocase activity is essential for chromatin remodelling, because the enzyme binds the nucleosome at a fixed position and draws in the extranucleosomal linker DNA4. As ScSnf2 binds both strands of the nucleosomal DNA, the tracking strand could not be identified easily. To ascertain the directionality of DNA translocation, we compared the structure of the ScSnf2–nucleosome complex with that of helicase/translocase NS3 (Fig. 5a)29, which also shows a 3′-5′ polarity. It has been proposed that the core1–core2 cleft of NS3 undergoes an open-to-close transition during the ATPase cycle, which is essential for propelling DNA translocation.

Figure 5: Directionality of DNA translocation driven by Snf2.

a, Superimposition of the structure of ScSnf2 bound to the NCP and that of NS3 (grey, PDB accession number 3KQH)29 bound to single-stranded DNA (orange) in the absence of nucleotide. The core1 domains of the proteins are aligned. Arrow indicates the proposed direction of DNA translocation. b, Comparison of the structures of the ATPase active sites of ScSnf2 and NS3 (grey). P-loop (motif I) of Snf2 is blue. The ‘arginine fingers’ of ScSnf2 and NS3 are shown as stick models. Arrow indicates the proposed movement of the core2 domain relative to the core1 domain upon ATP binding.

PowerPoint slide

Full size image

Superposition of the core1 domains of ScSnf2 and NS3 in the nucleotide-free state showed that their core2 domains adopt similar positions (Fig. 5b). The β-hairpin of NS3, which is essential for the unwinding of double-stranded DNA29, is absent in ScSnf2, consistent with the lack of helicase activity of the remodeller1. The 5′-strand of the nucleosomal DNA overlays well with the single-stranded DNA bound by NS3 with the same polarity, suggesting the 5′-DNA strand functions as the tracking strand when ScSnf2 binds to double-stranded DNA. By analogy to NS3, ATP binding and hydrolysis would lead to closure of the core1–core2 cleft. Because ScSnf2 is anchored at a fixed position on the nucleosome, this relative movement of the core domains would pump the linker DNA towards the dyad (Fig. 5a), consistent with the directionality of DNA translocation during a chromatin remodelling reaction4,30. The assignment of the directionality of chromatin remodelling is also supported by the higher-resolution structure at SHL6 (Extended Data Fig. 3).

Distortion of the nucleosomal DNA

Owing to the extensive interactions with the catalytic core of ScSnf2, both strands of the nucleosomal DNA around SHL2 are locally distorted, with the surrounding sequence lifted off from its canonical path on the surface of the histone octamer and the phosphate backbone of the 3′-strand showing a dramatic displacement as far as ~5 Å (Fig. 6a, b). Given the greater flexibility of the proximal entry-point DNA of NCP-167, the local DNA distortion near SHL2 would probably cause a relatively smaller energy penalty, which provides a rationale for the observed preference of Snf2 binding at this DNA segment over the distal DNA end.

Figure 6: Model of nucleosome sliding by Snf2.

a, Superimposition of the structures of nucleosomal DNA bound by ScSnf2 at SHL2 (red and yellow), free NCP-145 (cyan, PDB accession number 2NZD)33 and ‘601’ NCP bound by RCC1 (grey, PDB accession number 3MVD)21. Boxed region is analysed further in b. c, An enzyme-centred view of DNA translocation mediated by Snf2. The primary (1°) and secondary (2°) DNA gyres of the nucleosome bound by Snf2 are indicated as circles. The red arrow indicates the relative contraction motion of the core1 and core2 domains during the ATPase cycle. d, A substrate-centred view of DNA translocation. Snf2, green circle; H4 tail, gold. The bulging/looping out of 1 bp of the DNA at SHL2 is schematically illustrated. The red arrow indicates the direction of DNA loop propagation driven by contraction of the remodeller.

PowerPoint slide

Full size image Discussion

Nucleosomal DNA displays intrinsic plasticity31. Different structures of the NCP show variable DNA stretching around SHL±2 and SHL±5. The gain or loss of 1 bp at these sites has been proposed to facilitate the remodelling reaction32. Compared with the structure of NCP with 145-bp DNA33, the NCP with the ‘601’ positioning sequence contains 1 bp of extra DNA around SHL ± 2, leading to bulging/looping out of the DNA backbone at these positions21,31 (Fig. 6a).

Snf2 engages with the NCP at the strategic site of SHL2, leading to further bulging out of the DNA components of the nucleosome substrate at the site of engagement (Fig. 6c, d). Our structure suggests that the interactions of Snf2 with the adjacent DNA gyre through its secondary DNA-binding surface may help to anchor the enzyme at SHL2, which is further stabilized by the binding to the nearby H4 tail. Substrate engagement triggers conformational changes of the enzyme, bringing motifs I and VI closer in space, and poses Snf2 for ATP hydrolysis. Thus, NCP binding primes both the remodeller and its chromatin substrate for the subsequent reaction. It is conceivable that ATP binding and hydrolysis would then induce closure of the DNA-binding core1–core2 cleft, and deliver 1 bp of the DNA at SHL2 towards the dyad, initiating the remodelling reaction.

This mechanism of DNA translocation by Snf2 is consistent with the notion that the ATPase domain of the remodeller is an autonomous machine, and it remodels the nucleosome 1–2 bp at a time6,30. A ‘wave–ratchet–wave’ model for chromatin remodelling has been proposed, in which a tracking subdomain remains bound at a fixed position on the histone octamer, and a torsion subdomain undergoes a conformational change and pulls the DNA4. Our findings suggest the core1 and core2 domains of Snf2 may function as the tracking and torsion subdomains, respectively, and their relative movement during the ATPase cycles would then drive translocation of the nucleosomal DNA.

In summary, our findings illustrate how Snf2 engages with the nucleosome substrate, which provides the structural basis of chromatin remodelling. This basic mechanism of nucleosome sliding probably also applies to the ISWI and Chd1 subfamilies of remodellers.

Methods

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.

Protein expression and purification

ScSnf2 (residues 666–1400) and the related mutant proteins were expressed and purified similarly as described before7. The nucleosomes were constituted with 167 bp DNA containing the ‘601’ positioning sequence (5′-strand: ATCGTACTTCTCGACAAGCTTCAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCGAT; the ‘601’ positioning sequence is underlined).

H4 tail (residues 1–21) from S. cerevisiae was cloned into a modified pET-28b vector with the His-tag deleted and a glutathione S-transferase (GST)-tag added to the carboxy (C) terminus. The H4 tail point mutants were generated by QuikChange mutagenesis. Recombinant proteins were overexpressed in the Escherichia coli expression strain Rosetta(DE3) and induced with 0.5 mM isopropyl-β-D-thiogalactoside (IPTG). Proteins were purified by GST column, followed by an ion-exchange column (Source-15S, GE Healthcare) with HEPES buffer, pH 7.0, then subjected to gel-filtration chromatography (Superdex-200, GE Healthcare) in buffer containing 10 mM HEPES, pH 7.0, 50 mM NaCl and 5 mM dithiothreitol (DTT). The purified protein was concentrated to 10 mg ml−1 and stored at −80 °C.

ATPase and remodelling activities

ATPase and remodelling activities were measured as described before7. To measure the basal DNA-independent ATPase activities, 1 μM proteins were used. To measure the ATPase activities of the proteins in the activated state, 25 nM protein was used in the presence of 125 nM double-stranded DNA (147 bp) or 125 nM NCP147.

To compare the remodelling activities, 5 nM cy5-labelled 347-bp mononucleosomes were incubated with 1 nM protein, 3 mM ATP and 40 U of HhaI in remodelling buffer (20 mM Tris-HCl, pH 8.0, 20 mM KAc, 30 mM NaCl, 5 mM MgCl2 and 0.1 mg ml−1 bovine serum albumin). Gels were analysed by a Typhoon Trio+ imager and quantified with the Quantity One program.

GST pull-down assay

Pull-down assays were performed at 4 °C in the binding buffer containing 50 mM NaCl, 20 mM HEPES, pH 7.5 and 3 mM DTT. GST-tagged proteins (7.5 μM) and GST alone (control) were pre-incubated with GST beads, and then mixed with 8 μM ScSnf2 (666–1400) proteins. After gentle rotation for 60 min, the GST beads were washed four times with the binding buffer and eluted in 200 mM NaCl, 20 mM Tris-HCl, pH 8.0, 3 mM DTT and 30 mM glutathione. The samples were mixed with SDS loading buffer and electrophoresed at 240 V for 35 min on 12% SDS–polyacrylamide gel electrophoresis. Gels were analysed by Coomassie blue staining.

Sample preparation and EM data collection

The ScSnf2 (666–1400)–NCP complexes were obtained by mixing 15 μM protein with 5 μM NCP-167. We purified and stabilized the complex using the GraFix method34. To form the gradient, 6 ml top solution containing 50 mM NaCl, 10 mM HEPES, pH 7.0 and 10% glycerol (Sigma) was added to a tube (Beckman, 331372). Bottom solution (6 ml) containing 50 mM NaCl, 10 mM HEPES, pH 7.0, 30% glycerol and 0.15% glutaraldehyde (Polysciences) was then injected to the bottom of the tube using a syringe with a blunt-ended needle. The tubes were placed into a gradient master (BioComp) to form a continuous density and glutaraldehyde gradient. Finally, 200 μl of sample were loaded. The sample tubes were ultracentrifuged at 4 °C for 20 h at a speed of 35,000 r.p.m. (Beckman, Rotor SW-41Ti). Fractions were collected every 200 μl, and were examined by electrophoresis at 70 V for 90 min on 4.5% native TBE polyacrylamide gels on ice. The gels were stained with SYBR Gold and analysed on a Chemi-Doc XR+ system (Bio-Rad). The best fraction was selected and dialysed to 50 mM NaCl, 10 mM Tris-HCl, pH 8.0 and 3 mM DTT and concentrated for EM sample preparation.

Negative-staining samples were prepared using 0.75% uranyl formate. Holey grids coated with continuous carbon film were glow discharged, and then 4 μl of sample were loaded. The grids were first blotted using filter paper, then washed with water and uranyl formate, sequentially. The samples were observed using a 200 kV Tecnai F20 microscope (FEI) equipped with a Gatan Ultrascan 4000 camera at a magnification of ×62,000, corresponding to pixel size of 1.35 Å on the images. Defocus ranging from −1.0 to −2.5 μm and a total dose of ~40 electrons per square ångström were used.

For cryo-EM sample preparation, a drop of 4 μl sample was applied to a glow-discharged Quantifoil holey carbon grid (R1.2/1.3, 300 mesh). After waiting for 60 s, the grid was blotted for 4.0 s (under 100% humidity and 8 °C) and plunged into liquid ethane cooled by liquid nitrogen using FEI Vitrobot IV. The samples were observed using a Titan Krios microscope (FEI) operated at 300 kV, equipped with a Gatan K2 Summit camera. UCSFImage4 was used for data collection under a defocus range of 1.8–3.2 μm and nominal magnification of ×22,500, corresponding to pixel size 0.66 Å of super-resolution counting mode35. Each micrograph was dose-fractionated to 32 frames with 0.25 s exposure time in each frame. The dose rate was 8.2 counts per physical pixel per second, and the total dose was ~50 electrons per square ångström.

Image processing and model building

For negative-staining micrographs, CTFFIND3 was used to estimate the defocus parameters36. A total of 13,863 particles were picked using the ‘e2boxer.py’ subroutine in the EMAN2 suit37. Two-dimensional classification was performed with RELION 1.4 to screen and remove most bad particles38. Then a sphere generated by SPIDER was used as the initial model for the first round of three-dimensional classification39. After two rounds of three-dimensional classification, 9,824 particles were selected, and subjected to the final three-dimensional reconstruction. The cryo-EM super-resolution micrographs were 2 × 2 binned, yielding an image stack with a pixel size of 1.32 Å. Motion correction was performed using the MotionCorr program, which output motion-corrected integrated images for further processing40. CTFFIND3 was used to determine defocus parameters. A total of 630,847 particles were picked using an automated in-house software suit. All subsequent two- and three-dimensional image analyses were performed with RELION 1.4. After several rounds of two-dimensional classification, 462,321 particles were selected and divided into free NCP (254,777 particles), NCP–Snf2 complex (200,625 particles) and 2Snf2–NCP complex (6,919 particles) for further three-dimensional classification. A cylinder initial model generated with SPIDER and the negative-staining model were used as initial models for the first round of three-dimensional classification for the free NCP and the NCP–Snf2 complex, respectively. After two rounds of three-dimensional classification, 63,311 free NCP particles were selected and subjected to three-dimensional auto-refinement. Then particle polishing and further three-dimensional auto-refinement were applied, which resulted in a final free NCP map at 3.92 Å resolution estimated with the gold-standard Fourier shell correlation (FSC) 0.143 criterion41.

A total of 200,625 NCP–Snf2 complex particles were also subjected to three-dimensional classification based on the low-resolution signals. Although the density of linker DNA was weak, the low-resolution signal of this linker was still strong and could be visualized as solid density after applying a low-pass filter to 10 Å resolution (Extended Data Fig. 2 inset). The presence of linker DNA and the asymmetrical nature of the NCP-167 allowed two different binding conformations to be identified, with Snf2 binding to SHL6 (the SHL6 complex) and SHL2 (the SHL2 complex) of the NCP, respectively. Another round of three-dimensional classification was performed for the SHL6 complex subset with 127,232 particles and the SHL2 complex subset with 73,393 particles, respectively. Then, 90,725 and 42,383 particles were selected from these two subsets, and subjected to ‘polishing’ and ‘auto-refinement’ procedures, respectively. Finally, three-dimensional reconstructions of the SHL6 and SHL2 complexes were calculated at resolutions of 3.97 Å and 4.69 Å, respectively. To improve the resolution of the Snf2 protein part, NCP was subtracted from the experimental particle images, and the remaining particles were processed following a focused classification procedure42. Local resolutions of all maps were estimated using Resmap37. After three-dimensional classification, 5,597 particles of 2Snf2–NCP were selected for auto-refinement and to acquire a map at 11.26 Å resolution.

The structural model was built first by fitting the crystal structures of the NCP (PDB accession number 3MVD)21, the individual core domains of MtSnf2 (PDB accession number 5HZR)7 and the H4 tail bound by MtISWI (PDB accession number 5JXT)9 to the EM density map using UCSF Chimera43. The model was further refined using phenix.realrealspace44 with secondary structure constraints and rebuilt manually in Coot.

Data availability

Coordinates and EM maps have been deposited in the Electron Microscopy Data Bank and PDB under accession numbers EMD-6699 and 5X0X (the SHL6 complex), and EMD-6700 and 5X0Y (the SHL2 complex), respectively. All other data are available from the corresponding authors upon reasonable request.

References

Clapier, C. R. & Cairns, B. R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 78, 273–304 (2009)

Article   CAS   Google Scholar

Narlikar, G. J., Sundaramoorthy, R. & Owen-Hughes, T. Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes. Cell 154, 490–503 (2013)

Article   CAS   Google Scholar

Luger, K., Mäder, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389, 251–260 (1997)

Article   ADS   CAS   Google Scholar

Saha, A., Wittmeyer, J. & Cairns, B. R. Chromatin remodelling: the industrial revolution of DNA around histones. Nature Rev. Mol. Cell Biol. 7, 437–447 (2006)

Article   CAS   Google Scholar

Becker, P. B. & Hörz, W. ATP-dependent nucleosome remodeling. Annu. Rev. Biochem. 71, 247–273 (2002)

Article   CAS   Google Scholar

Mueller-Planitz, F., Klinker, H. & Becker, P. B. Nucleosome sliding mechanisms: new twists in a looped history. Nature Struct. Mol. Biol. 20, 1026–1032 (2013)

Article   CAS   Google Scholar

Xia, X., Liu, X., Li, T., Fang, X. & Chen, Z. Structure of chromatin remodeler Swi2/Snf2 in the resting state. Nature Struct. Mol. Biol. 23, 722–729 (2016)

Article   CAS   Google Scholar

Hauk, G., McKnight, J. N., Nodelman, I. M. & Bowman, G. D. The chromodomains of the Chd1 chromatin remodeler regulate DNA access to the ATPase motor. Mol. Cell 39, 711–723 (2010)

Article   CAS   Google Scholar

Yan, L., Wang, L., Tian, Y., Xia, X. & Chen, Z. Structure and regulation of the chromatin remodeller ISWI. Nature 540, 466–469 (2016)

Article   ADS   CAS   Google Scholar

Leschziner, A. E. Electron microscopy studies of nucleosome remodelers. Curr. Opin. Struct. Biol. 21, 709–718 (2011)

Article   CAS   Google Scholar

Watanabe, S. et al. Structural analyses of the chromatin remodelling enzymes INO80-C and SWR-C. Nature Commun. 6, 7108 (2015)

Article   ADS   CAS   Google Scholar

Tosi, A. et al. Structure and subunit topology of the INO80 chromatin remodeler and its nucleosome complex. Cell 154, 1207–1219 (2013)

Article   CAS   Google Scholar

Nguyen, V. Q. et al. Molecular architecture of the ATP-dependent chromatin-remodeling complex SWR1. Cell 154, 1220–1231 (2013)

Article   CAS   Google Scholar

Yamada, K. et al. Structure and mechanism of the chromatin remodelling factor ISW1a. Nature 472, 448–453 (2011)

Article   ADS   CAS   Google Scholar

Racki, L. R. et al. The chromatin remodeller ACF acts as a dimeric motor to space nucleosomes. Nature 462, 1016–1021 (2009)

Article   ADS   CAS   Google Scholar

Leschziner, A. E., Lemon, B., Tjian, R. & Nogales, E. Structural studies of the human PBAF chromatin-remodeling complex. Structure 13, 267–275 (2005)

Article   CAS   Google Scholar

Lowary, P. T. & Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol. 276, 19–42 (1998)

Article   CAS   Google Scholar

Zofall, M., Persinger, J., Kassabov, S. R. & Bartholomew, B. Chromatin remodeling by ISW2 and SWI/SNF requires DNA translocation inside the nucleosome. Nature Struct. Mol. Biol. 13, 339–346 (2006)

Article   CAS   Google Scholar

Dechassa, M. L. et al. Disparity in the DNA translocase domains of SWI/SNF and ISW2. Nucleic Acids Res. 40, 4412–4421 (2012)

Article   CAS   Google Scholar

Dechassa, M. L. et al. Architecture of the SWI/SNF-nucleosome complex. Mol. Cell. Biol. 28, 6010–6021 (2008)

Article   CAS   Google Scholar

Makde, R. D., England, J. R., Yennawar, H. P. & Tan, S. Structure of RCC1 chromatin factor bound to the nucleosome core particle. Nature 467, 562–566 (2010)

Article   ADS   CAS   Google Scholar

Clapier, C. R. et al. Regulation of DNA translocation efficiency within the chromatin remodeler RSC/Sth1 potentiates nucleosome sliding and ejection. Mol. Cell 62, 453–461 (2016)

Article   CAS   Google Scholar

Szerlong, H. et al. The HSA domain binds nuclear actin-related proteins to regulate chromatin-remodeling ATPases. Nature Struct. Mol. Biol. 15, 469–476 (2008)

Article   CAS   Google Scholar

Fan, H. Y., Trotter, K. W., Archer, T. K. & Kingston, R. E. Swapping function of two chromatin remodeling complexes. Mol. Cell 17, 805–815 (2005)

Article   CAS   Google Scholar

Clapier, C. R. & Cairns, B. R. Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes. Nature 492, 280–284 (2012)

Article   ADS   CAS   Google Scholar

Dürr, H., Körner, C., Müller, M., Hickmann, V. & Hopfner, K. P. X-ray structures of the Sulfolobus solfataricus SWI2/SNF2 ATPase core and its complex with DNA. Cell 121, 363–373 (2005)

Article   Google Scholar

Smith, C. L. & Peterson, C. L. A conserved Swi2/Snf2 ATPase motif couples ATP hydrolysis to chromatin remodeling. Mol. Cell. Biol. 25, 5880–5892 (2005)

Article   CAS   Google Scholar

Saha, A., Wittmeyer, J. & Cairns, B. R. Chromatin remodeling through directional DNA translocation from an internal nucleosomal site. Nature Struct. Mol. Biol. 12, 747–755 (2005)

Article   CAS   Google Scholar

Gu, M. & Rice, C. M. Three conformational snapshots of the hepatitis C virus NS3 helicase reveal a ratchet translocation mechanism. Proc. Natl Acad. Sci. USA 107, 521–528 (2010)

Article   ADS   CAS   Google Scholar

Harada, B. T. et al. Stepwise nucleosome translocation by RSC remodeling complexes. eLife 5, 5 (2016)

Article   Google Scholar

Tan, S. & Davey, C. A. Nucleosome structural studies. Curr. Opin. Struct. Biol. 21, 128–136 (2011)

Article   CAS   Google Scholar

Mueller-Planitz, F., Klinker, H., Ludwigsen, J. & Becker, P. B. The ATPase domain of ISWI is an autonomous nucleosome remodeling machine. Nature Struct. Mol. Biol. 20, 82–89 (2013)

Article   CAS   Google Scholar

Ong, M. S., Richmond, T. J. & Davey, C. A. DNA stretching and extreme kinking in the nucleosome core. J. Mol. Biol. 368, 1067–1074 (2007)

Article   CAS   Google Scholar

Stark, H. GraFix: stabilization of fragile macromolecular complexes for single particle cryo-EM. Methods Enzymol. 481, 109–126 (2010)

Article   CAS   Google Scholar

Li, X., Zheng, S., Agard, D. A. & Cheng, Y. Asynchronous data acquisition and on-the-fly analysis of dose fractionated cryoEM images by UCSFImage. J. Struct. Biol. 192, 174–178 (2015)

Article   Google Scholar

Mindell, J. A. & Grigorieff, N. Accurate determination of local defocus and specimen tilt in electron microscopy. J. Struct. Biol. 142, 334–347 (2003)

Article   Google Scholar

Ludtke, S. J. 3-D structures of macromolecules using single-particle analysis in EMAN. Methods Mol. Biol. 673, 157–173 (2010)

Article   CAS   Google Scholar

Bharat, T. A., Russo, C. J., Löwe, J., Passmore, L. A. & Scheres, S. H. Advances in single-particle electron cryomicroscopy structure determination applied to sub-tomogram averaging. Structure 23, 1743–1753 (2015)

Article   CAS   Google Scholar

Frank, J. et al. SPIDER and WEB: processing and visualization of images in 3D electron microscopy and related fields. J. Struct. Biol. 116, 190–199 (1996)

Article   CAS   Google Scholar

Li, X. et al. Electron counting and beam-induced motion correction enable near-atomic-resolution single-particle cryo-EM. Nature Methods 10, 584–590 (2013)

Article   CAS   Google Scholar

Scheres, S. H. & Chen, S. Prevention of overfitting in cryo-EM structure determination. Nature Methods 9, 853–854 (2012)

Article   CAS   Google Scholar

Bai, X. C., Rajendra, E., Yang, G., Shi, Y. & Scheres, S. H. Sampling the conformational space of the catalytic subunit of human γ-secretase. eLife 4, 4 (2015)

Article   Google Scholar

Pettersen, E. F. et al. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004)

Article   CAS   Google Scholar

Afonine, P. V. et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D 68, 352–367 (2012)

Article   CAS   Google Scholar

Download references

Acknowledgements

We thank J. Lei at the Center for Structural Biology (Tsinghua University) and the staff at the Tsinghua University Branch of the National Center for Protein Sciences Beijing for providing facility support. This work was supported by the National Key Research and Development Program to Z.C. (2014CB910100) and to X.L (2016YFA0501102 and 2016YFA0501902), the National Natural Science Foundation of China to Z.C. (31570731, 31270762, 31630046) and to X.L. (31570730), Advanced Innovation Center for Structural Biology, Tsinghua-Peking Joint Center for Life Sciences, and the ‘Junior One Thousand Talents’ program to Z.C. and X.L.

Author information Author notes

Xiaoyu Liu, Meijing Li and Xian Xia: These authors contributed equally to this work.

Authors and Affiliations

Ministry of Education Key Laboratory of Protein Science, Tsinghua University, Beijing, 100084, China

Xiaoyu Liu, Meijing Li, Xian Xia, Xueming Li & Zhucheng Chen

School of Life Sciences, Tsinghua University, Beijing, 100084, China

Xiaoyu Liu, Meijing Li, Xian Xia, Xueming Li & Zhucheng Chen

Tsinghua-Peking Joint Center for Life Sciences, Beijing, 100084, China

Xiaoyu Liu, Meijing Li & Xueming Li

Contributions

X.Liu and X.X. prepared the proteins and performed the biochemical analyses; M.L. collected the EM data with help from X.Liu and X.X.; M.L. and X.Li performed the EM analysis; Z.C. wrote the manuscript with help from all authors; Z.C. directed and supervised all the research.

Corresponding authors

Correspondence to Xueming Li or Zhucheng Chen.

Ethics declarations Competing interests

The authors declare no competing financial interests.

Additional information

Reviewer Information Nature thanks B. Bartholomew, T. Owen-Hughes and the other anonymous reviewer(s) for their contribution to the peer review of this work.

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables Extended Data Figure 1 Negative-staining and cryo-EM structure analysis.

a, Representative micrograph of negative staining. b, Two-dimensional class averages of characteristic projection views of negative-staining particles. c, Negative-staining density map of SHL6 complex. d, Representative micrograph of cryo-EM sample. e, Fast Fourier transforms of image in d, with the Thon rings extending to ~3.5 Å. f, Two-dimensional class averages of characteristic projection views of cryo-EM particles of the Snf2–NCP complex. g, Angular distribution of particle projections of the SHL6 complex. h, Angular distribution of particle projections of the SHL2 complex. i, Cryo-EM density map of free NCP coloured on the basis of the local resolution and angular distribution of particle projections. j, Cryo-EM density map of the Snf2 part of the SHL6 complex coloured on the basis of the local resolution. k, Cryo-EM density map of the Snf2 part of the SHL2 complex coloured on the basis of the local resolution. l, The ‘gold-standard’ FSC curve calculated between two halves of data sets for the SHL6 complex, Snf2 (SHL6), the SHL2 complex, Snf2 (SHL2) and free nucleosome. m, Two-dimensional class averages of characteristic projection views of cryo-EM particles of the 2Snf2–NCP complex.

Extended Data Figure 2 Flow chart of cryo-EM data processing.

Inset: low-resolution models to show the linker DNA that helped to orient the complex. For the SHL6 complex, the model was acquired from the yellow class (14.8%); SHL2 complex, grey class (20.0%); 2Snf2–NCP complex, structure with two copies of Snf2 bound to the same NCP at SHL2 (pink) and SHL6 (red). Scale bar, 2 nm.

Extended Data Figure 3 Comparison of the structure of Snf2 bound at SHL2 and SHL6.

Snf2 bound at SHL2 is coloured as in Fig. 2, and that at SHL6 is coloured grey. Only the primary DNA is shown, with 5′- and 3′-strands bound by the Snf2 at SHL6 coloured magenta and orange, respectively. Red arrow indicates the proposed direction of DNA translocation driven by Snf2.

Extended Data Figure 4 Superposition of the structure and the EM density map.

a, Local resolution of the cryo-EM density map of the SHL2 complex. b, Segmented map of the nucleosome part of the SHL2 complex. c, Segmented map of ScSnf2. d, Region around W1185 of the SHL2 complex. Segmented maps of Snf2 and the 3′-DNA are coloured green and yellow, respectively. e, Region around R880 of the SHL6 complex.

Extended Data Figure 5 Conformational changes of Snf2 upon nucleosome binding.

The structure of core1 domains of MtSnf2 in the resting state (grey, PDB accession number 5HZR)7 was aligned with that of ScSnf2 (green) in complex with the NCP. For clarity, only the structure around the central β-sheets of the remodellers is shown. The core2 domains in the resting state and in the substrate state are coloured blue and cyan, respectively. The elements for ATP hydrolysis (motifs I and VI) are in red. Motif VI is disordered in the resting state, and becomes a helical structure in the nucleosome-bound state. The arrow indicates the movement of core2 domain relative to the core1 domain upon the binding of the nucleosome.

Extended Data Figure 6 Chromatin remodelling activities of various constructs used in this study.

a, Gels of the restriction enzyme-accessibility assays of ScSnf2 (666–1400) with wild-type interface and three core1–core2 interface mutants. The cut fractions were quantified and shown in Fig. 2g. Three independent assays were performed and one was shown. b, Gels of the restriction enzyme accessibility assays of three DNA-binding mutant ScSnf2 (666–1400). The cut fractions are shown in Fig. 3d. c, Gels of the restriction enzyme accessibility assays of three mutant ScSnf2 (666–1400) containing DNA-binding mutations in the secondary DNA-binding sites. The cut fractions were quantified and are shown in Fig. 4d. d, Gels of the restriction enzyme accessibility assays of ScSnf2 (666–1400) with wild-type interface towards gH4-NCP (left), H4-binding KK mutation of Snf2 towards intact NCP (middle) and KK mutant Snf2 towards gH4-NCP (right). The cut fractions were quantified and are shown in Extended Data Fig. 8f.

Extended Data Figure 7 Superposition of the structures of the core2 domains of ScSnf2 (cyan) and MtISWI (grey).

The Brace helices of ScSnf2 are shown in red; NegC of MtISWI (PBD code 5JXT)9 is in orange. V1235 of ScSnf2 is equivalent to V638 of MtISWI.

Extended Data Figure 8 Interactions between the histone H4 tail and ScSnf2.

a, Binding of the histone H4 tail to a highly negatively charged surface of ScSnf2. Electrostatic surface of ScSnf2 was calculated with Pymol. Red, negative electrostatic potential; blue, positive electrostatic potential. b, Superimposition of the structure of the ScSnf2–NCP complex, the EM density map around the H4 tail (filtered to a resolution of 7.0 Å, gold) and the crystal structure of the core2 domain of MtISWI (grey, PDB accession number 5JXT)9 in complex with the H4 tail (magenta). Acidic residues of MtISWI surrounding the H4-binding pocket are shown as sticks and labelled (grey), and the corresponding residues of ScSnf2 are also labelled (cyan). c, GST pull-down assays of ScSnf2 (666–1400) with intact interface and the H4-binding KK mutant. The experiments were repeated at least three times, and the representative gel shown. GST alone was used as a negative control. d, ATPase activities of ScSnf2 (666–1400) with wild-type interface (black) and KK mutation (red) in the resting state (-), and in the presence of DNA and NCP. e, GST pull-down assays of ScSnf2 (666–1400) with wild-type and four mutant H4 tail peptides. f, Chromatin remodelling activities of ScSnf2 (666–1400) with wild-type interface (black) and KK mutation (red) towards intact (filled symbols) and mutant gH4 (open symbols) NCPs. For gel source data, see Supplementary Fig. 1.

Extended Data Figure 9 Superposition of the structures of ScSnf2 and SsoRad54 (grey).

The structures of the core1 domains of ScSnf2 and SsoRad54 (PDB accession number 1Z63)26 are aligned. The DNA bound by SsoRad54 is coloured light blue. The six DNA-binding elements of ScSnf2 (motifs Ia, Ib, II, IV, V and core2i) are labelled and coloured blue. Motifs IV and V of SsoRad54 are coloured magenta.

Supplementary information Supplementary Information

This file contains the uncropped blots. (PDF 1292 kb)

PowerPoint slides PowerPoint slide for Fig. 1 PowerPoint slide for Fig. 2 PowerPoint slide for Fig. 3 PowerPoint slide for Fig. 4 PowerPoint slide for Fig. 5 PowerPoint slide for Fig. 6 Rights and permissions

Reprints and permissions

About this article Cite this article

Liu, X., Li, M., Xia, X. et al. Mechanism of chromatin remodelling revealed by the Snf2-nucleosome structure. Nature 544, 440–445 (2017). https://doi.org/10.1038/nature22036

Download citation

Received 01 August 2016

Accepted 28 February 2017

Published 19 April 2017

Issue Date 27 April 2017

DOI https://doi.org/10.1038/nature22036

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable link

Provided by the Springer Nature SharedIt content-sharing initiative

Subjects Chromatin remodelling Cryoelectron microscopy This article is cited by Subnucleosome preference of human chromatin remodeller SMARCAD1 Pengjing HuJingxi SunZhucheng Chen

Nature (2025)

Nanoscale analysis of human G1 and metaphase chromatin in situ Jon Ken ChenTingsheng LiuLu Gan

The EMBO Journal (2025)

A competitive regulatory mechanism of the Chd1 remodeler is integral to distorting nucleosomal DNA Ilana M. NodelmanHeather J. FolkweinGregory D. Bowman

Nature Structural & Molecular Biology (2025)

Mechanisms of chromatin remodeling by the human Snf2-type ATPase SNF2H Deepshikha MalikAshish DeshmukhMario Halic

Cell Research (2025)

Molecular and structural basis of the chromatin remodeling activity by Arabidopsis DDM1 Akihisa OsakabeYoshimasa TakizawaHitoshi Kurumizaka

Nature Communications (2024)